Bitte benutzen Sie diese Kennung, um auf die Ressource zu verweisen:
http://bibliotecavirtual.dgb.umich.mx:8083/xmlui/handle/DGB_UMICH/2081
Titel: | Identificación molecular y caracterización morfológica de Sphaceloma perseae en la franja aguacatera de Michoacán |
Autor(en): | Correa Juárez, Mariela |
Adviser: | Ochoa Ascencio, Salvador |
Stichwörter: | info:eu-repo/classification/cti/6 FAPJ-M-2019-1290 Interacción planta-microorganismo-insecto Elsinoe Roña |
Erscheinungsdatum: | Aug-2019 |
Herausgeber: | Universidad Michoacana de San Nicolás de Hidalgo |
Zusammenfassung: | The avocado scab is a disease that affects young fruits and leaves of avocado (Persea americana Mill). On fruits, the lesions have a circular pattern of 3-10 mmd diameter with an irregular margin. These lesions have a purple-brown coloration. Initially, the lesions are scattered that develops a corky texture resulting in the rupture of the epidermis and may produce a mass of conidiophores and hyaline conidia. On leaves, the infection occurs on the adaxial and abaxial surfaces in the form of circular lesions that produces small perforations with a corky edge. The scab is caused by the fungus Sphaceloma perseae Jenkins and it is present in avocado producing countries in Africa, Asia and America. In Mexico, it is reported as a disease with wide distribution and the main impact is the appearance of the fruit that limits its acceptability in the market. The main objective of this study was the molecular identification and morphological characterization of different isolates of Sphaceloma perseae obtained from different avocado fruits with symptoms of scab. These isolates were obtained from five agro-ecological regions of avocado in Michoacan. Four hundred and fifty isolates were obtained from initial lesions of four-month-old fruits, from which 112 isolates were confirmed as Sphaceloma perseae by PCR with the use of specific primers, SpF5 (GACCGAACCAACTCTTGCAC) and SpR6 (CCACACGCCCAATACCAA), for this fungus. One hundred and twelve isolates were grouped by morphological similarity in 26 morphotypes and characterized under growth conditions in two culture media, PDA and EMA, and two incubation temperatures, 21 and 25 ºC. La roña es una enfermedad que afecta los frutos y hojas jóvenes del aguacate (Persea americana Mill). En el fruto, las lesiones son elevadas de color púrpura o marrón a casi negro y de 3 a 10 mm de diámetro, con frecuencia en patrón circular con un margen irregular. Las lesiones aparecen inicialmente dispersas y cuando se unen forman una región corchosa con fisuras marrones, que rompen la epidermis y producen una densa cubierta afelpada de conidióforos y conidios hialinos. En hojas la infección ocurre en las superficies adaxial y abaxial en forma de lesiones afelpadas circulares, que se desprenden y forman pequeñas perforaciones con borde corchoso. La roña del aguacate es causada por el hongo Sphaceloma perseae Jenkins y está presente en países productores de aguacate en África, Asia y América. En México, se reporta como una enfermedad de amplia distribución y su impacto principal es sobre la apariencia del fruto que limita su aceptabilidad en el mercado, más que en la productividad del cultivo. El objetivo del presente trabajo fue la identificación molecular y caracterización morfológica de Sphaceloma perseae a partir de aislados obtenidos de frutos de aguacate con síntomas de roña, procedentes de cinco regiones agroecológicas de la franja aguacatera de Michoacán. Se obtuvieron 450 aislados a partir de lesiones iniciales en frutos de cuatro meses de edad, de los cuales 112 aislados fueron confirmados como Sphaceloma perseae mediante PCR con el uso de iniciadores específicos para esta especie SpF5 (GACCGAACCAACTCTTGCAC) y SpR6 (CCACACGCCCAATACCAA). Los 112 aislados fueron agrupados por similitud morfológica en 26 morfotipos y caracterizados bajo condiciones de crecimiento en dos medios de cultivo (PDA y EMA) y dos temperaturas de incubación (21 y 25 ºC). |
Beschreibung: | Instituto de Investigaciones Agropecuarias y Forestales. Facultad de Biología. Facultad de Medicina Veterinaria y Zootecnia. Facultad de Agrobiología. Facultad de Químico Farmacobiología. Programa Institucional de Maestría en Ciencias Biológicas |
URI: | http://bibliotecavirtual.dgb.umich.mx:8083/xmlui/handle/DGB_UMICH/2081 |
Enthalten in den Sammlungen: | Maestría |
Dateien zu dieser Ressource:
Datei | Beschreibung | Größe | Format | |
---|---|---|---|---|
FAPJ-M-2019-1290.pdf | 1.37 MB | Adobe PDF | Öffnen/Anzeigen |
Alle Ressourcen in diesem Repository sind urheberrechtlich geschützt, soweit nicht anderweitig angezeigt.